Vicbio Biotechnology Co., Ltd.

+86-19501900054
support@vicbio.com
Product Name Nebulabio | NBPD-101591 | MC1109 Probe
Catalog Number NBPD-101591
Alias/Synonyms MC1109 Probe
Appearance N/A
Molecule Weight N/A
CAS N/A
Solubility N/A
Storage Store at 4°C for short-term, -20°C for long-term. Avoid repeated freezing and thawing cycles.
Shelf Life See COA
Additional info 1 Ship with Ice Pack.
Additional info 2 For Research Use Only.
Catalog Numbe Size Price Inventory Level  
NBPD-101591 10 Tests, 20 Tests 咨询 咨询


Nebulabio | NBPD-101591 | MC1109 Probe


Product Name: NebuProbe™ MC1109 Probe

Catalog Number: NBPD-101591

Size: 10 Tests, 20 Tests

Brand: Nebulabio


Description

NebuProbe™ MC1109 Probe (Cat# NBPD-101591) is designed to detect the microbes: Methanococcales; Sequence: GCAACATAGGGCACGGGTCT

Label

Green/Red/Aqua/Orange/DIG/BIO
Location N/A
Synonym MC1109 Probe
Application These probes were specific when tested against a panel of nucleic acids from closely related bacteria.
Storage Store at 4°C for short-term, -20°C for long-term. Avoid repeated freezing and thawing cycles.


Top-selling Items